Day: October 14, 2022

Chen, Kai; Kang, Qi-Kai; Li, Yuntong; Wu, Wen-Qiang; Zhu, Hui; Shi, Hang published the artcile< Catalytic Amination of Phenols with Amines>, Product Details of C6H8N2, the main research area is aryl amine preparation; phenol amine amination rhodium catalyst.

Herein, a rhodium-catalyzed amination of phenols, which provided concise access to diverse anilines, with water as the sole byproduct was described. The arenophilic rhodium catalyst facilitated the inherently difficult keto-enol tautomerization of phenols by means of π-coordination, allowing for the subsequent dehydrative condensation with amines. The generality of this redox-neutral catalysis by carrying out reactions of a large array of phenols with various electronic properties and a wide variety of primary and secondary amines was demonstrated. Several examples of late-stage functionalization of structurally complex bioactive mols., including pharmaceuticals, further illustrated the potential broad utility of the method.

Journal of the American Chemical Society published new progress about Amination. 3731-53-1 belongs to class pyridine-derivatives, and the molecular formula is C6H8N2, Product Details of C6H8N2.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Li, Lifan; Song, Xuyan; Qi, Mei-Fang; Sun, Bing published the artcile< Weak Bronsted base-promoted photoredox catalysis for C-H alkylation of heteroarenes mediated by triplet excited diaryl ketone>, Related Products of 350-03-8, the main research area is alkylated heteroarene regioselective preparation; heteroarene ether CH alkylation photoredox catalysis.

A weak Bronsted base-promoted photoredox catalysis had been developed for the direct C-H α-alkylation of heteroarenes with cyclic and acyclic ethers. The high efficiency of this strategy was demonstrated by the mild reaction conditions, broad substrate scope, economical reagents and high regioselectivity. With air as the sole oxidant, a set of alkylated heteroarenes were accessed smoothly. This strategy was also applied for late-stage functionalization of valuable vitamin E nicotinate and loratadine.

Tetrahedron Letters published new progress about Alkylation catalysts. 350-03-8 belongs to class pyridine-derivatives, and the molecular formula is C7H7NO, Related Products of 350-03-8.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Dong, Wei; Ge, Zemei; Wang, Xin; Li, Ridong; Li, Runtao published the artcile< Cu-mediated one-pot three-component synthesis of 3-N-substituted 1,4,2-benzodithiazine 1,1-dioxide derivatives>, HPLC of Formula: 3731-53-1, the main research area is halobenzenesulfonamide amine carbon disulfide copper catalyst three component reaction; amino benzodithiazine dioxide preparation.

A novel and efficient copper-catalyzed one-pot procedure for the synthesis of 3-N-substituted 1,4,2-benzodithiazine 1,1-dioxide derivatives from 2-halobenzenesulfonamides, amines and CS2 was described. The reaction proceeded through Ullmann-type S-arylation, intramol. addition of NH2 with C=S and dehydrosulfide, which provided a new and useful strategy for construction of cyclic aromatic sulfonamides.

Tetrahedron published new progress about Amines Role: RCT (Reactant), SPN (Synthetic Preparation), RACT (Reactant or Reagent), PREP (Preparation). 3731-53-1 belongs to class pyridine-derivatives, and the molecular formula is C6H8N2, HPLC of Formula: 3731-53-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Giri, Bishnubasu; Saini, Taruna; Kumbhakar, Sadananda; Selvan K, Kalai; Muley, Arabinda; Misra, Ashish; Maji, Somnath published the artcile< Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects>, Reference of 366-18-7, the main research area is anthraceneylterpyridine ruthenium bipyridine nitrosyl complex preparation electrochem redox phototoxicity; IR light induced photorelease nitric oxide ruthenium nitrosyl complex; one electron reduction anthraceneylterpyridine ruthenium bipyridine nitrosyl complex; crystal mol structure anthraceneylterpyridine ruthenium bipyridine nitroxide complex.

Polypyridyl backbone nitrosyl complexes of ruthenium with the mol. framework [RuII(antpy)(bpy)NO+/ ̇]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2”-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatog. purification, all the synthesized complexes were fully characterized using different spectroscopic and anal. techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the mol. integrity of the complexes, the structure of [3](PF6) was successfully determined by x-ray crystallog. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 x 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 x 10-2 min-1 (t1/2 ∼ 21 min), resp., when exposed to a 200 W Xenon light. Addnl., the photo-cleavage of Ru-NO occurred within ~2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature The first-order rate constant of 9.4 x 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biol. relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chem. (hydrazine hydrate), electrochem. and biol. In the biol. reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97μM).

Dalton Transactions published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Zhang, Penglin; Zhang, Min; Ji, Yuqi; Xing, Mimi; Zhao, Qian; Zhang, Chun published the artcile< Nickel-Catalyzed Highly Selective Hydroalkenylation of Alkenyl Boronic Esters to Access Allyl Boron>, Application of C13H15F3N2O, the main research area is nickel catalyzed hydroalkenylation alkenyl boronic ester cyclohexenyl triflate; boronate allyl preparation oxidation; allyl alc preparation.

Allyl B derivatives are valuable building blocks in the synthesis of natural products and bioactive mols. Herein, a practical strategy of Ni-catalyzed highly selective hydroalkenylation of alkenyl boronic esters was developed. Under the mild reaction conditions, a variety of allyl boronic esters were accessed with excellent chemo- and regioselectivity. The mechanism of this transformation was illustrated by control experiments and kinetic studies.

Organic Letters published new progress about Alkenylation catalysts (Ni complexes). 1416819-91-4 belongs to class pyridine-derivatives, and the molecular formula is C13H15F3N2O, Application of C13H15F3N2O.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Jia, Jidong; Zhang, Xueru; Wang, Yuxiao; Shi, Yufang; Sun, Jinyu; Yang, Junyi; Song, Yinglin published the artcile< Enhanced Two-Photon Absorption of Cross-Conjugated Chalcone Derivatives: Modulation of the Effective π-Conjugated Structure>, Recommanded Product: 1-(Pyridin-3-yl)ethanone, the main research area is enhanced photon absorption cross conjugated chalcone derivative modulation effective.

Three cross-conjugated chalcone derivatives T3CT, T3CP2, and T3CP3 were designed and synthesized to develop excellent organic nonlinear optical (NLO) materials. In a Z-scan experiment, all compounds show good NLO absorption characteristics in the visible to near-IR region. The photophys. mechanism is confirmed to be two-photon absorption (TPA)-induced excited-state absorption (ESA). Intramol. charge transfer (ICT) observed in transient absorption spectra (TAS) significantly affects mol. NLO properties. We define the π-conjugated system that dominates the electron transition process in the cross-conjugated structure as the effective π-conjugated structure. Electron transition anal. shows a sufficiently strong ICT can effectively expand the effective π-conjugated structure in these cross-conjugated structures. The TPA cross sections of these compounds at 650 and 750 nm are only in the range of 17-97 GM. However, we achieve a significant enhancement of the TPA cross section at 580 nm (1737-2027 GM) by extending the effective π-conjugated structure. Excited by 580 nm femtosecond laser pulses, all compounds exhibit excellent OL performance and the min. OL threshold is 4.71 x 10-3 J/cm2. The results show that these cross-conjugated chalcone derivatives have promising applications in OL, and their NLO performance can be effectively improved by modulating the effective π-conjugated structure.

Journal of Physical Chemistry A published new progress about Conjugation (bond). 350-03-8 belongs to class pyridine-derivatives, and the molecular formula is C7H7NO, Recommanded Product: 1-(Pyridin-3-yl)ethanone.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Smolyar, N. N.; Yutilov, Yu. M. published the artcile< Reduction of 2-amino-3- and -5-nitropyridine derivatives with hydrazine hydrate>, Related Products of 21901-29-1, the main research area is nitropyridinamine reduction hydrazine hydrate; pyridinamine preparation.

The reactions of 3- and 5-nitro-2-pyridinamine with N2H4.H2O resulted in elimination of the NH2 group and reduction of the NO2 group with formation of 3-pyridinamine. A probable reaction mechanism involves addition of N2H4.H2O to the N-C(2) bond, followed by elimination of NH3 and reduction of the NO2 group to NH2. 4- And 5-methyl-3-nitro-2-pyridinamine reacted with N2H4.H2O in a similar way.

Russian Journal of Organic Chemistry published new progress about Aromatic amines Role: RCT (Reactant), SPN (Synthetic Preparation), RACT (Reactant or Reagent), PREP (Preparation). 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Related Products of 21901-29-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Tkachuk, Viktor M.; Lukianov, Oleh O.; Vovk, Mykhailo V.; Gillaizeau, Isabelle; Sukach, Volodymyr A. published the artcile< Chan-Evans-Lam N1-(het)arylation and N1-alkenylation of 4-fluoroalkylpyrimidin-2(1H)-ones>, Related Products of 329214-79-1, the main research area is substituted pyrimidone preparation; fluoroalkylpyrimidinone boronic acid arylation alkenylation copper catalyst; alkenylboronic acid pinacol ester fluoroalkylpyrimidinone arylation alkenylation copper catalyst; Chan–Evans–Lam reaction; C–N cross-coupling; boronic acids; fluoroalkyl group; pyrimidin-2(1Н)-ones.

The Chan-Evans-Lam reaction of 1-unsubstituted 4-fluoroalkylpyrimidin-2(1H)-ones with arylboronic acids was reported as a facile synthetic route to hitherto unavailable N1-(het)aryl and N1-alkenyl derivatives of the corresponding pyrimidines I [R = CH=CH2, Ph, 3-thienyl, etc.; R1 = CHF2, CF3, C2F5, CClF2; R2 = H, Br, CO2Me]. An efficient C-N bond-forming process was also observed by using boronic acid pinacol esters as coupling partners in the presence of Cu(II) acetate and boric acid. The 4-fluoroalkyl group on the pyrimidine ring significantly assists in the formation of the target N1-substituted products, in contrast to the 4-Me and 4-unsubstituted substrates which did not undergo N1-arylation under similar reaction conditions.

Beilstein Journal of Organic Chemistry published new progress about Alkenylation. 329214-79-1 belongs to class pyridine-derivatives, and the molecular formula is C11H16BNO2, Related Products of 329214-79-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Huo, Shuaicong; Kong, Siqi; Zeng, Guang; Feng, Qi; Hao, Zhiqiang; Han, Zhangang; Lin, Jin; Lu, Guo-Liang published the artcile< Efficient access to quinolines and quinazolines by ruthenium complexes catalyzed acceptorless dehydrogenative coupling of 2-aminoarylmethanols with ketones and nitriles>, Product Details of C7H7NO, the main research area is quinoline preparation; quinazoline preparation; ketone aminoarylmethanol dehydrogenative coupling reaction ruthenium catalyst; nitrile aminoarylmethanol dehydrogenative coupling reaction ruthenium catalyst.

Treatment of N,N,O-tridentate pyrazolyl-pyridinyl-alc. ligands, I (R = H, Me; R1 = H, Me, Ph; R2 = Me, Ph) with RuCl3·xH2O in refluxing EtOH afforded the corresponding Ru(III) complexes II, as chlorides, which were well characterized by IR, HR-MS and X-ray single crystal structural determination These Ru complexes II showed similarly high catalytic performance for both dehydrogenative couplings of 2-aminoarylmethanols [2-NH2-3-R3-5-R4C6H2CH2OH (R3 = H, Me, Br; R4 = H, F, Cl, Br) and 3-amino-3-phenyl-1-propanol] with ketones [R5C(O)CH3 (R5 = Ph, pyridin-3-yl, thiophen-2-yl, etc.), cycloheptanone and 1,2,3,4-tetrahydronaphthalen-1-one] and nitriles R6CN (R6 = Ph, 3-bromophenyl, thien-2-yl, etc.), giving the quinolines III, IV, V and 2,6-diphenylpyridine and quinazolines VI in good to excellent yields. This protocol provides an atom-economical and sustainable route to access various structurally important quinolines III, IV, V and 2,6-diphenylpyridine and quinazolines VI derivatives by using phosphine-free ligand based Ru catalysts II.

Molecular Catalysis published new progress about Amino alcohols Role: RCT (Reactant), RACT (Reactant or Reagent). 350-03-8 belongs to class pyridine-derivatives, and the molecular formula is C7H7NO, Product Details of C7H7NO.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Timperley, Christopher M.; Banks, R. Eric; Young, Ian M.; Haszeldine, Robert N. published the artcile< Synthesis of some fluorine-containing pyridinealdoximes of potential use for the treatment of organophosphorus nerve-agent poisoning>, Name: 2-Amino-3-nitro-6-picoline, the main research area is fluorinated pyridinealdoxime preparation treatment organophosphorus nerve agent poisoning; sarin poisoning fluorinated pyridinealdoxime preparation treatment.

Fluoroheterocyclic aldoximes were screened as therapeutic agents for the treatment of anticholinesterase poisoning. 2-Fluoropyridine-3- and -6-aldoxime and 3-fluoropyridine-2- and -4-aldoxime were synthesized. Attempts to obtain 3,5,6-trifluoropyridine-2,4-bis(aldoxime) and -2-aldoxime, however, proved unsuccessful. Pentafluorobenzaldoxime was prepared by oximation of pentafluorobenzaldehyde. Acid dissociation constants (pKa) and second-order rate constants (kox-) of the fluorinated pyridinealdoximes towards sarin were measured. 2,3,5,6-Tetrafluoropyridine-4-aldoxime had the best profile: its kox- approached that of the therapeutic oxime P2S (310 vs. 120 l mol-1 min-1), but its higher pKa (9.1 vs. 7.8) fell short of the target figure of 8 required for reactivation of inhibited acetylcholinesterase in vivo. N-alkylation of the fluorinated pyridine-aldoximes may reduce their pKa nearer to 8 and enhance their therapeutic potential.

Journal of Fluorine Chemistry published new progress about Antidotes. 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Name: 2-Amino-3-nitro-6-picoline.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem