Category: 366-18-7

Hasanzadeh Esfahani, Maryam; Iranmanesh, Hasti; Beves, Jonathon E.; Kaur, Manpreet; Jasinski, Jerry P.; Behzad, Mahdi published the artcile< Crystal structures and antibacterial properties of Cu(II) complexes containing an unsymmetrical N2O Schiff base ligand and bidentate N-donor heterocyclic co-ligands>, Safety of 2,2′-Bipyridine, the main research area is copper Schiff propanediamine salicylaldehyde complex preparation; crystal structure copper Schiff propanediamine salicylaldehyde complex.

Three new Cu(II) Schiff base complexes with bidentate N-donor heterocyclic co-ligands, 2,2′-bipyridine (1), 1,10-phenanthroline (2), and 2,9-dimethyl-1,10-phenanthroline (3), were synthesized and characterized by FTIR and UV-visible spectroscopy. Mol. structures of [C20H21CuN4O](ClO4) (1) and [C24H25CuN4O](ClO4) (3) were characterized by single-crystal x-ray crystallog. The Schiff base ligand is an N2O-type ligand, which is the mono-condensed form of the reaction between 1,3-propanediamine and salicylaldehyde. The antibacterial activities of these complexes were studied against one gram pos. and four gram neg. bacteria. Considerable antibacterial activity was obtained against both gram type bacteria. Complexes 2 and 3 with 1,10-phenanthroline and 2,9-dimethyl-1,10-phenanthroline, resp., showed better antibacterial activity compared to which has the 2,2′-bipyridine co-ligand.

Journal of Coordination Chemistry published new progress about Antibacterial agents. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Safety of 2,2′-Bipyridine.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Li, Jun-Xia; Du, Zhong-Xiang; Zhang, Lu-Lu; Liu, Duo-Li; Pan, Qiu-Yue published the artcile< Doubly mononuclear co-crystal and oxalato-bridged binuclear copper compounds containing flexible 2-((3,5,6-trichloropyridin-2-yl)oxy)acetate tectons: Synthesis, crystal analysis and magnetic properties>, Quality Control of 366-18-7, the main research area is copper trichloropyridinyloxyacetate oxalato bipyridine preparation crystal structure.

Two new Cu compounds, [Cu(3,5,6-tcpa)2(H2O)4]·[Cu(3,5,6-tcpa)2(H2O)2] (1) and [Cu2(3,5,6-tcpa)2(2,2′-bipy)2(oxa)]·2EtOH (2) (3,5,6-Htcpa = 2-((3,5,6-trichloro pyridin-2-yl)oxy)acetic acid, 2,2′-bipy = 2,2′-bipyridine, oxa = oxalate dianion), were synthesized by solvothermal method and systematically characterized. Single-crystal x-ray diffraction anal. show that 1 is an interesting double mononuclear co-crystal and consists of two discrete and stereochem. different complexes: one octahedral, the other tetrahedral about the Cu centers. While for 2, two equivalent Cu ions are in square pyramidal geometry and linked by oxalate anion forming a novel binuclear cluster. The O-H···O H bonds, Cl···Cl halogen bonds and/or π···π stacking interactions play an important part in construction of the 3-dimensional networks for 1 and 2. The magnetic measurements indicate that there is weak antiferromagnetic coupling between two Cu ions in 1 and 2. Notably, compound 2 also can be obtained in a higher yield with 1 as one of the starting material and the driving force for this transition process was carefully discussed.

Inorganica Chimica Acta published new progress about Antiferromagnetic exchange. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Quality Control of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Chauhan, Archana; Langyan, Ritu published the artcile< Preparation and optical features of samarium(III) complexes introducing bidentate fluorinate and secondary ligands>, HPLC of Formula: 366-18-7, the main research area is samarium complex bidentate fluorinate optical feature secondary ligand.

The syntheses of five luminescent samarium(III) complexes based on 6-Fluoro-4-oxo-4H-1-benzopyran-3-carboxaldehyde (L) and bidentate ancillary ligands were reported. The bidentate ancillary ligands were 1, 10-phenanthroline, 2, 2′-bipyridine, neocuproine, and bathophenanthroline. The complexes were characterized by employing elemental anal., UV, FTIR, ESI-MS+ spectrometry, TGA, FESEM, and PXRD. The luminescence properties of complexes in solution and powder state have been discussed to investigate optical characterization. The complexes display characteristic luminescence peaks of samarium(III) ion at ∼ 566, 600, and 647 nm. Different coordination environments around samarium(III) ion in DMSO solution and powder state result in different emission colors: bright orange and red color with intense peaks at ∼ 600 nm and ∼ 647 nm. The luminescent quantum yield, decay time, CCT, and CIE coordinates were considered. The replacement of aqua ligands by the bidentate subsidiary ligands from the parent complex enriched emission properties, thermal stability, decay time, and quantum yields. Interesting optical properties of complexes in the orange-red spectral region might be useful in electronic devices, bio-assays, and liquid lasers.

Journal of Materials Science: Materials in Electronics published new progress about Bidentate ligands Role: TEM (Technical or Engineered Material Use), USES (Uses). 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, HPLC of Formula: 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Decker, Katherine T.; Gao, Ye; Rychel, Kevin; Al Bulushi, Tahani; Chauhan, Siddharth M.; Kim, Donghyuk; Cho, Byung-Kwan; Palsson, Bernhard O. published the artcile< proChIPdb: a chromatin immunoprecipitation database for prokaryotic organisms>, HPLC of Formula: 366-18-7, the main research area is Escherichia proChIPdb prokaryotic organisms transcription factors nucleotides regulons.

The transcriptional regulatory network in prokaryotes controls global gene expression mostly through transcription factors (TFs), which are DNA-binding proteins. Chromatin immunoprecipitation (ChIP) with DNA sequencing methods can identify TF binding sites across the genome, providing a bottom-up, mechanistic understanding of how gene expression is regulated. ChIP provides indispensable evidence toward the goal of acquiring a comprehensive understanding of cellular adaptation and regulation, including condition-specificity. ChIP-derived data’s importance and labor-intensiveness motivate its broad dissemination and reuse, which is currently an unmet need in the prokaryotic domain. To fill this gap, we present proChIPdb, an information-rich, interactive web database. This website collects public ChIP-seq/-exo data across several prokaryotes and presents them in dashboards that include curated binding sites, nucleotide-resolution genome viewers, and summary plots such as motif enrichment sequence logos. Users can search for TFs of interest or their target genes, download all data, dashboards, and visuals, and follow external links to understand regulons through biol. databases and the literature. This initial release of proChIPdb covers diverse organisms, including most major TFs of Escherichia coli, and can be expanded to support regulon discovery across the prokaryotic domain.

Nucleic Acids Research published new progress about Chromatin. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, HPLC of Formula: 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Hachey, Austin C.; Havrylyuk, Dmytro; Glazer, Edith C. published the artcile< Biological activities of polypyridyl-type ligands: implications for bioinorganic chemistry and light-activated metal complexes>, Reference of 366-18-7, the main research area is ligand polypyridyl phenanthroline bioinorganic chem metal complex; 1,10-Phenanthroline; Chemotherapy; Copper; Iron; Ligand; Natural products; Polypyridyl; Ruthenium.

Polypyridyl coordinating ligands are common in metal complexes used in medicinal inorganic chem. These ligands possess intrinsic cytotoxicity, but detailed data on this phenomenon are sparse, and cytotoxicity values vary widely and are often irreproducible. To provide new insights into the biol. effects of bipyridyl-type ligands and structurally related metal-binding systems, reports of free ligand cytotoxicity were reviewed. The cytotoxicity of 25 derivatives of 2,2-bipyridine and 1,10-phenanthroline demonstrates that there is no correlation between IC50 values and ligand properties such as pKa, log D, polarizability volume, and electron d., as indicated by NMR shifts. As a result of these observations, as well as the various reported mechanisms of action of polypyridyl ligands, we offer the hypothesis that biol. effects are governed by the availability of and affinity for specific metal ions within the exptl. model.

Current Opinion in Chemical Biology published new progress about Bioinorganic chemistry. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Pillalamarri, Vijaykumar; Reddy, Chilakala Gangi; Bala, Sandeep Chowdary; Jangam, Aruna; Kutty, Vinny Vinod; Addlagatta, Anthony published the artcile< Methionine aminopeptidases with short sequence inserts within the catalytic domain are differentially inhibited: Structural and biochemical studies of three proteins from Vibrio spp.>, Name: 2,2′-Bipyridine, the main research area is methionine aminopeptidase inhibitor drug target; Cholera; Drug discovery; MetAP; Methionine aminopeptidase; Vibrio.

Methionine aminopeptidases (MetAPs) have been recognized as drug targets and have been extensively studied for discovery of selective inhibitors. MetAPs are essential enzymes in all living cells. While most prokaryotes contain a single gene, some prokaryotes and all eukaryotes including human have redundancy. Due to the similarity in the active sites of the MetAP enzyme between the pathogens and human limited the success of discovering selective inhibitors. We recently have discovered that MetAPs with small inserts within the catalytic domain to have different susceptibilities against some inhibitors compared to those that do not have. Using this clue we used bioinformatic tools to identify new variants of MetAPs with inserts in pathogenic species. Two new isoforms were identified in Vibrio species with two and three inserts in addition to an isoform without any insert. Multiple sequence alignment suggested that inserts are conserved in several of the Vibrio species. Two of the three inserts are common between two and three insert isoforms. One of the inserts is identified to have “”NNKNN”” motif that is similar to well-characterized quorum sensing peptide, “”NNWNN””. Another insert is predicted to have a posttranslational modification site. Three Vibrio proteins were cloned, expressed, purified, enzyme kinetics established and inhibitor screening has been performed. Several of the pyridinylpyrimidine derivatives selectively inhibited MetAPs with inserts compared to those that do not have, including the human enzyme. Crystal structure and mol. modeling studies provide the mol. basis for selective inhibition.

European Journal of Medicinal Chemistry published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Name: 2,2′-Bipyridine.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Kumar, Manish; Kumar, Gyanendra; Mogha, Navin Kumar; Jain, Ritu; Hussain, Firasat; Masram, Dhanraj T. published the artcile< Structure, DNA/proteins binding, docking and cytotoxicity studies of copper(II) complexes with the first quinolone drug nalidixic acid and 2,2'-dipyridylamine>, Quality Control of 366-18-7, the main research area is crystal structure copper nalidixate dipyridylamine; copper nalidixate dipyridylamine preparation DNA HSA BSA binding cytotoxicity; Copper complexes; Crystal structure; Cytotoxicity; DFT calculations; DNA and proteins binding studies; Molecular docking studies.

This work presents the synthesis, structural characterization and biol. affinity of the newly synthesized Cu(II) complexes with the 1st antibacterial quinolone drug nalidixic acid (nal) [Cu(nal)2(H2O)], (1) or N-donor ligand 2,2′-dipyridylamine (bipyam). [Cu(II)(nal)(bipyam)Cl], (2) reveals a distorted square pyramidal based geometry in Cu(II) atom confirmed by x-ray crystallog. technique. The theor. stabilities and optimized structures of the complex were obtained from DFT calculations The ability of the complexes to bind with calf thymus DNA (CT DNA) were studied by electronic absorption, fluorescence, CD, and viscosity measurements techniques. The complexes strongly interact with CT DNA via intercalative mode but complex 2 exhibits the highest affinity giving Kb = 3.91 ± 0.13 × 106, M-1. The fluorescence spectroscopy measurements show that both complexes have the superior ability to the replacement of EtBr from DNA-bound EtBr solution and bind to DNA through intercalative mode. Both complex also shows the superior affinity towards proteins with comparatively high binding constant values which were further revealed by fluorescence spectroscopy measurements. Mol. docking anal. indicates that the interaction of the complexes and proteins are stabilized by H bonding and hydrophobic interaction. Also, the results of in vitro cytotoxicity reveal that the complex 2 has excellent cytotoxicity than 1 against human breast cancer cell lines (MCF-7).

Spectrochimica Acta, Part A: Molecular and Biomolecular Spectroscopy published new progress about Antitumor agents. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Quality Control of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Liu, Ya-Nan; Hou, Jin-Le; Wang, Zhi; Gupta, Rakesh Kumar; Jaglicic, Zvonko; Jagodic, Marko; Wang, Wen-Guang; Tung, Chen-Ho; Sun, Di published the artcile< An Octanuclear Cobalt Cluster Protected by Macrocyclic Ligand: In Situ Ligand-Transformation-Assisted Assembly and Single-Molecule Magnet Behavior>, Quality Control of 366-18-7, the main research area is octanuclear cobalt silsesquioxane sandwich cluster preparation crystal mol structure; hexamethylcyclohexasiloxanolate cobalt octanuclear sandwich preparation single mol magnet; protected macrocyclic ligand transformation assisted mol magnet behavior.

Macrocyclic mols. with multiple coordination sites have been widely used as promising ligands to build polynuclear metal clusters; however, cyclic silsesquioxane-based metal clusters are still rare. Herein, authors report a new octanuclear Co-silsesquioxane cluster [Co8(OH)2{(MeSiO2)6}2(bpy)2(Obpy)2] (SD/Co8c; SD = SunDi), wherein the Co8 disk-like core is sandwiched by two hexamethylcyclohexasiloxanolate ligands (MeSiO2)6 at two poles and finally encircled by two bpy (bpy = 2,2′-bipyridine) and two Obpy (HObpy = 6-hydroxy-2,2′-bipyridine) ligands at the equatorial region. Interestingly, both MeSi(OMe)3 and bpy undergo in situ transformations to generate hexameric cyclic (MeSiO2)6 and Obpy, resp. The unusual hydroxylation of bpy and the OH- anion in the center of Co8 core provide addnl. binding sites to induce the formation of the larger cluster instead of the traditional hexanuclear cluster. The solution stability and fragmentation route in the gas phase were studied by cold-spray ionization and collision-induced dissociation mass spectrometry, resp. Both results reveal that the Co8 core is quite stable in solution as well as in the gas phase, even with increased collision voltage. Magnetic susceptibility studies of SD/Co8c show the slow magnetization relaxation indicative of single-mol. magnet (SMM) behavior. This work not only presents the multiple in situ ligand-transformation-assisted assembly of polynuclear cobalt cluster but also provides some new insights into the magnetism-structure relationship for SMMs.

Inorganic Chemistry published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Quality Control of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Halevas, E.; Papadopoulos, T. A.; Swanson, C. H.; Smith, G. C.; Hatzidimitriou, A.; Katsipis, G.; Pantazaki, A.; Sanakis, I.; Mitrikas, G.; Ypsilantis, K.; Litsardakis, G.; Salifoglou, A. published the artcile< In-depth synthetic, physicochemical and in vitro biological investigation of a new ternary V(IV) antioxidant material based on curcumin>, SDS of cas: 366-18-7, the main research area is ternary vanadium curcumin bipyridine complex preparation antioxidant crystal structure; Bioreactivity profile and antioxidant agent; Cell metabolism inhibition and DNA degradation; Crystal structure and DFT calculations; Hybrid metallopharmaceutical; ROS-suppression; Vanadium-curcumin complex.

Curcumin is a natural product with a broad spectrum of beneficial properties relating to pharmaceutical applications, extending from traditional remedies to modern cosmetics. The biol. activity of such pigments, however, is limited by their solubility and bioavailability, thereby necessitating new ways of achieving optimal tissue cellular response and efficacy as drugs. Metal ion complexation provides a significant route toward improvement of curcumin stability and biol. activity, with vanadium being a representative such metal ion, amply encountered in biol. systems and exhibiting exogenous bioactivity through potential pharmaceuticals. Driven by the need to optimally increase curcumin bioavailability and bioactivity through complexation, synthetic efforts were launched to seek out stable species, ultimately leading to the synthesis and isolation of a new ternary V(IV)-curcumin-(2,2′-bipyridine) complex. Physicochem. characterization (elemental anal., FT-IR, Thermogravimetry (TGA), UV-Visible, NMR, ESI-MS, Fluorescence, X-rays) portrayed the solid-state and solution properties of the ternary complex. Pulsed-EPR spectroscopy, in frozen solutions, suggested the presence of two species, cis- and trans-conformers. D. Functional Theory (DFT) calculations revealed the salient features and energetics of the two conformers, thereby complementing EPR spectroscopy. The well-described profile of the vanadium species led to its in vitro biol. investigation involving toxicity, cell metabolism inhibition in S. cerevisiae cultures, Reactive Oxygen Species (ROS)-suppressing capacity, lipid peroxidation, and plasmid DNA degradation A multitude of bio-assays and methodologies, in comparison to free curcumin, showed that it exhibits its antioxidant potential in a concentration-dependent fashion, thereby formulating a bioreactivity profile supporting development of new efficient vanado-pharmaceuticals, targeting (extra)intra-cellular processes under (patho)physiol. conditions.

Journal of Inorganic Biochemistry published new progress about Antioxidants. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, SDS of cas: 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Giri, Bishnubasu; Saini, Taruna; Kumbhakar, Sadananda; Selvan K, Kalai; Muley, Arabinda; Misra, Ashish; Maji, Somnath published the artcile< Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects>, Reference of 366-18-7, the main research area is anthraceneylterpyridine ruthenium bipyridine nitrosyl complex preparation electrochem redox phototoxicity; IR light induced photorelease nitric oxide ruthenium nitrosyl complex; one electron reduction anthraceneylterpyridine ruthenium bipyridine nitrosyl complex; crystal mol structure anthraceneylterpyridine ruthenium bipyridine nitroxide complex.

Polypyridyl backbone nitrosyl complexes of ruthenium with the mol. framework [RuII(antpy)(bpy)NO+/ ̇]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2”-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatog. purification, all the synthesized complexes were fully characterized using different spectroscopic and anal. techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the mol. integrity of the complexes, the structure of [3](PF6) was successfully determined by x-ray crystallog. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 x 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 x 10-2 min-1 (t1/2 ∼ 21 min), resp., when exposed to a 200 W Xenon light. Addnl., the photo-cleavage of Ru-NO occurred within ~2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature The first-order rate constant of 9.4 x 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biol. relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chem. (hydrazine hydrate), electrochem. and biol. In the biol. reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97μM).

Dalton Transactions published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem