Giri, Bishnubasu’s team published research in Dalton Transactions in 2020 | 366-18-7

Dalton Transactions published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Giri, Bishnubasu; Saini, Taruna; Kumbhakar, Sadananda; Selvan K, Kalai; Muley, Arabinda; Misra, Ashish; Maji, Somnath published the artcile< Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects>, Reference of 366-18-7, the main research area is anthraceneylterpyridine ruthenium bipyridine nitrosyl complex preparation electrochem redox phototoxicity; IR light induced photorelease nitric oxide ruthenium nitrosyl complex; one electron reduction anthraceneylterpyridine ruthenium bipyridine nitrosyl complex; crystal mol structure anthraceneylterpyridine ruthenium bipyridine nitroxide complex.

Polypyridyl backbone nitrosyl complexes of ruthenium with the mol. framework [RuII(antpy)(bpy)NO+/ ̇]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2”-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatog. purification, all the synthesized complexes were fully characterized using different spectroscopic and anal. techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the mol. integrity of the complexes, the structure of [3](PF6) was successfully determined by x-ray crystallog. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 x 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 x 10-2 min-1 (t1/2 ∼ 21 min), resp., when exposed to a 200 W Xenon light. Addnl., the photo-cleavage of Ru-NO occurred within ~2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature The first-order rate constant of 9.4 x 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biol. relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chem. (hydrazine hydrate), electrochem. and biol. In the biol. reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97μM).

Dalton Transactions published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem